Quality, affordable solutions for your life sciences needs.

United Bioinformatica Inc Bioinformatics Software Products Bioinformatics Services Site Map of UBI Contact UBI Search in United Bioinformatica Inc
United Bioinformatica Inc.
  Top » Catalog My Account  |  Cart Contents  |  Checkout   
HP Taq DNA Polymerase Let's See What We Have Here

Description

Taq DNA polymerase (recombinant) is a thermostable DNA polymerase isolated from a strain of the bacterium Thermus aquaticus . This enzyme has both 5’ to 3’ polymerase and exonuclease activity but lacks 3’ to 5’ exonuclease activity. Taq DNA polymerase is an extremely heat stable enzyme, with a half life of 3 hours at 95°C. This stability enables primer extension reactions to occur at elevated temperatures that facilitate the formation of single stranded templates. Taq DNA polymerase has an error rate of 1 bp per million during DNA synthesis.


Protocol: High Purity Taq DNA Polymerase, Recombinant


Performance and Quality Testing
Taq DNA Polymerase is highly purified free of contaminating endonucleases, exonucleases and nicking activity. For endonuclease assay, 1 ug of Lambda / Hind III DNA is incubated with 20 units of the enzyme in assay buffer at 75oC for 16 hrs and no visible contaminating activity is observed; For exonucleases assay, 1 g of pBR322 plasmid DNA is incubated with 10 units of enzyme for 16 hrs at 75oC in assay buffer and no detectable exonuclease is observed. The purity of the enzyme is also evaluated by adding 10 units of Taq DNA Polymerase in 100 ul of a reaction mixture for making first strand cDNA at beginning and no impaired effect on the first strand is observed. For bacterial DNA assay, 1 to 5 Units of Taq DNA is incubated with using two highly conserved regions of the bacterial 16S RNA Primer 1: 5’ GGAGGAAGGTGGGGATGACG 3’ and Primer 2: 5’ATGGTGTGACGGGCGGTGTG 3’. No bacterial DNA was observed in the present lot of HTD0078.

Components

  • 200 ul Taq DNA Polymerase

  • 2 x 1.5 ml 10X Taq Reaction Buffer

  • 2 x 1.5 ml 20 mM Magnesium Sulfate

Storage Buffer

100 mM KCl, 20 mM Tris HCl (pH 8.75), 0.1 mM EDTA, 0.5 mM PMSF, 1mM DTT, 50% Glycerol.

10 X Taq Reaction Buffer

100 mM KCl, 100 mM (NH4)2SO4 , 200 mM Tris HCl (pH 8.75), 1%Triton X-100, 1mg/ml BSA.

Unit Definition

One unit incorporates 10 nmoles on dNTPs into acid-insoluble material in 30 minutes at 74°C.


Basic PCR Reaction
10X Taq Reaction Buffer
10 mM dNTP Mix
20 mM MgSO4
Primer Mix (10 uM each)
Template DNA
Taq DNA Polymerase
Water
Volume
10 ul
2 ul
1 ul
5 ul
1 to 20 ul
0.2 to 0.5 ul
up to 100 ul
Final Concentration
1x
0.2 mM
2 mM
0.5 uM (each)
x
1.0 – 2.5 U
x

QUALITY CONTROL ASSAY DATA

Endodeoxyribonuclease Assay

No detectable conversion of covalently closed circularDNA to nicked DNA was observed after incubation of 10 units of Taq DNA Polymerase with 1µg of pBR322 DNA in 50µl of Taq Buffer with KCl containing 1.5mM MgCl2 for 4 hours at 37°C. No detectable conversion of covalently closed circularDNA to nicked DNA was observed after incubation of 10 units of Taq DNA Polymerase with 1µg of pBR322 DNA in 50µl of Taq Buffer with KCl containing 1.5mM MgCl2 for 4 hours at 70°C.

Exodeoxyribonuclease Assay

No detectable degradation of lambda DNA/HindIII fragments was observed after incubation of 10 units of Taq DNA Polymerase with 1µg of digested DNA in 50µl of Taq Buffer with KCl containing 1.5mM MgCl2 for 4 hours at 37°C. No detectable degradation of lambda DNA/HindIII fragments was observed after incubation of 10 units of Taq DNA Polymerase with 1µg of digested DNA in 50µl of Taq Buffer with KCl containing 1.5mM MgCl2 for 4 hours at 70°C.

Bacterial DNA Assay

No detectable bacterial DNA was observed after Polymerase Chain Reaction using two highly conserved regions of the bacterial 16S RNA Primer 1: 5’ GGAGGAAGGTGGGGATGACG 3’ and Primer 2: 5’ATGGTGTGACGGGCGGTGTG 3’.The parameters were as follows: Denaturation for 30 s at 95oC, annealing for 30 s at 50 oC, and extending for 30 s at 70 oC

 

POLYMERASE ACTIVITY USING 16S RNA PRIMERS

ff 1. DNA Marker
2. LOT #76 plus E.Coli DNA Template
3. 5X LOT #76 (5Units)
4. 4X LOT #76 (4Units)
5. 3X LOT #76 (3Units)
6. 2X LOT #76 (2Units)
7. 1X LOT #76 (1Units)
8. 2X LOT #76 plus E.Coli DNA Template

 Quantity   Cat. No.   Product Name   Size   Unit   Price Per Unit   Price 
 HPTAQ-01  High Purity Taq DNA Polymerase, Recombinant  999.99   units   $0.11   $114.00 
Competitor  11304-011   500.00   units   $0.42   $211.00 

To order, enter the Quantity for the product(s) desired and click 'Add to Cart'

Checkout Reviews

United Bioinformatica Inc
Search in United Bioinformatica Inc

Site Map of UBI

Contact UBI
About Us
People
Partners
Customers
Support
Free Applications
Charity

Categories
Cloning Systems-> (6)
Competent Cells-> (17)
Deoxynucleotides (6)
DNA and RNA Kits-> (219)
DNA Ladders-> (7)
Enzymes-> (7)
Polymerases-> (3)
Special Order-> (69)
Manufacturers
Quick Find
 
Use keywords to find the product you are looking for.
Information
Shipping & Returns
Privacy Notice
Conditions of Use
Contact Us
Send To A Friend more
Refer a new customer to UBI by clicking on the button below and when your friend orders products over $300 (excluding taxes and shipping) the first time, you both receive a $20 gift card to Tim Horton's! Also, every time you refer a friend, you are automatically entered in a contest to receive a $500 pre paid VISA. Enter as many times as you like! Contest ends on June 15, 2008.
Send to a Friend
Specials more

dNTP set, (25 mM of each nucleotide)
$99.00

Send mail to webmaster with questions or comments about this web site.
Copyright 2001-2005 United Bioinformatica Inc.
Powered by FoundPages.