Performance and Quality Testing
Taq DNA Polymerase is highly purified free of contaminating endonucleases, exonucleases and nicking activity. For endonuclease assay, 1 ug of Lambda / Hind III DNA is incubated with 20 units of the enzyme in assay buffer at 75oC for 16 hrs and no visible contaminating activity is observed; For exonucleases assay, 1 g of pBR322 plasmid DNA is incubated with 10 units of enzyme for 16 hrs at 75oC in assay buffer and no detectable exonuclease is observed. The purity of the enzyme is also evaluated by adding 10 units of Taq DNA Polymerase in 100 ul of a reaction mixture for making first strand cDNA at beginning and no impaired effect on the first strand is observed. For bacterial DNA assay, 1 to 5 Units of Taq DNA is incubated with using two highly conserved regions of the bacterial 16S RNA Primer 1: 5’ GGAGGAAGGTGGGGATGACG 3’ and Primer 2: 5’ATGGTGTGACGGGCGGTGTG 3’. No bacterial DNA was observed in the present lot of HTD0078.
Components
- 200 ul Taq DNA Polymerase
- 2 x 1.5 ml 10X Taq Reaction Buffer
- 2 x 1.5 ml 20 mM Magnesium Sulfate
Storage Buffer
100 mM KCl, 20 mM Tris HCl (pH 8.75), 0.1 mM EDTA, 0.5 mM PMSF, 1mM DTT, 50% Glycerol.
10 X Taq Reaction Buffer
100 mM KCl, 100 mM (NH4)2SO4 , 200 mM Tris HCl (pH 8.75), 1%Triton X-100, 1mg/ml BSA.
Unit Definition
One unit incorporates 10 nmoles on dNTPs into acid-insoluble material in 30 minutes at 74°C.
Basic PCR Reaction
10X Taq Reaction Buffer
10 mM dNTP Mix
20 mM MgSO4
Primer Mix (10 uM each)
Template DNA
Taq DNA Polymerase
Water |
Volume
10 ul
2 ul
1 ul
5 ul
1 to 20 ul
0.2 to 0.5 ul
up to 100 ul |
Final Concentration
1x
0.2 mM
2 mM
0.5 uM (each)
x
1.0 – 2.5 U
x |
QUALITY CONTROL ASSAY DATA
Endodeoxyribonuclease Assay
No detectable conversion of covalently closed circularDNA to nicked DNA was observed after incubation of
10 units of Taq DNA Polymerase with 1µg of pBR322 DNA in 50µl of Taq Buffer with KCl containing 1.5mM MgCl2 for 4 hours at 37°C.
No detectable conversion of covalently closed circularDNA to nicked DNA was observed after incubation of
10 units of Taq DNA Polymerase with 1µg of pBR322 DNA in 50µl of Taq Buffer with KCl containing 1.5mM MgCl2 for 4 hours at 70°C.
Exodeoxyribonuclease Assay
No detectable degradation of lambda DNA/HindIII fragments was observed after incubation of 10 units of Taq DNA Polymerase with 1µg of digested DNA in 50µl of Taq Buffer with KCl containing 1.5mM MgCl2 for 4 hours at 37°C.
No detectable degradation of lambda DNA/HindIII fragments was observed after incubation of 10 units of Taq DNA Polymerase with 1µg of digested DNA in 50µl of Taq Buffer with KCl containing 1.5mM MgCl2 for 4 hours at 70°C.
Bacterial DNA Assay
No detectable bacterial DNA was observed after Polymerase Chain Reaction using two highly conserved regions of the bacterial 16S RNA Primer 1: 5’ GGAGGAAGGTGGGGATGACG 3’ and Primer 2: 5’ATGGTGTGACGGGCGGTGTG 3’.The parameters were as follows: Denaturation for 30 s at 95oC, annealing for
30 s at 50 oC, and extending for 30 s at 70 oC
POLYMERASE ACTIVITY USING 16S RNA PRIMERS
 |
1. DNA Marker
2. LOT #76 plus E.Coli DNA Template
3. 5X LOT #76 (5Units)
4. 4X LOT #76 (4Units)
5. 3X LOT #76 (3Units)
6. 2X LOT #76 (2Units)
7. 1X LOT #76 (1Units)
8. 2X LOT #76 plus E.Coli DNA Template
|
